Sayan Paul
@instem.res.in
Postdoctoral Researcher, Department of Biotechnology, Institute for Stem Cell Science and Regenerative Medicine
Institute for Stem Cell Science and Regenerative Medicine
RESEARCH INTERESTS
Genomics, Genetics, Transcriptomics, Molecular Biology
Scopus Publications
Scholar Citations
Scholar h-index
Scholar i10-index
Scopus Publications
Seithikurippu R. Pandi-Perumal, Konda Mani Saravanan, Sayan Paul, Ganesh Pandian Namasivayam, and Saravana Babu Chidambaram
Springer Science and Business Media LLC
Ranjith Kumavath, Honey Pavithran, Sayan Paul, V. Anju, Siddhardha Busi, and Madhu Dyavaiah
Spandidos Publications
Cancer is one of the leading causes of death worldwide and it is estimated that the mortality rate of cancer will increase in the coming years. The etiology of the development and progression of cancer is multifactorial. Insights have been gained on the association between the human microbiome and tumor cell malignancy. A number of commensal microbe species are present in the human gut. They serve pivotal roles in maintaining several health and disease conditions, such as inflammatory bowel disease, irritable bowel syndrome, obesity and diabetes. Known major factors involved in cancer development include age, hormone levels, alcohol consumption, diet, being overweight, obesity, and infections, regardless of the type of cancer. Therefore, the present review aims to discuss the relationship between the gut microbiome and obesity‑associated malignancies, including colorectal, gastric and liver cancer. Obesity has been reported to contribute to the development of numerous types of cancer primarily caused by high fatty food intake. In addition, obesity‑associated microbiome alterations can lead to cancer and its progression. Dysbiosis of the gut microbiota can alter the metabolite profile, whilst increasing the levels of toxins, such as Bacteroides fragilis toxin and colibactin and cytolethal distending toxin, which are responsible for oncogenesis. The present review provides insights into the impact of gut microbiome dysbiosis on the progression of different types of cancers associated with obesity. It also discusses possible strategies for preserving a healthy gut microbiome. Different pre‑clinical and clinical models are available for studying cancer development downstream of gut microbiome dysbiosis. Furthermore, the role of metabolites or drugs employed in colorectal, gastric and liver cancer therapy would be discussed.
Eswar Rao Tatta, Sayan Paul, and Ranjith Kumavath
Elsevier BV
Isha Rana, Sunny Kataria, Tuan Lin Tan, Edries Yousaf Hajam, Deepak Kumar Kashyap, Dyuti Saha, Johan Ajnabi, Sayan Paul, Shashank Jayappa, Akhil S.H.P. Ananthan,et al.
Elsevier BV
Pratul Kumar Jain, Shashank Jayappa, Thiagarajan Sairam, Anupam Mittal, Sayan Paul, Vinay J Rao, Harshil Chittora, Deepak K Kashyap, Dasaradhi Palakodeti, Kumarasamy Thangaraj,et al.
BMJ
BackgroundHypertrophic cardiomyopathy (HCM) is a genetic heart muscle disease with preserved or increased ejection fraction in the absence of secondary causes. Mutations in the sarcomeric protein-encoding genes predominantly cause HCM. However, relatively little is known about the genetic impact of signalling proteins on HCM.Methods and resultsHere, using exome and targeted sequencing methods, we analysed two independent cohorts comprising 401 Indian patients with HCM and 3521 Indian controls. We identified novel variants in ribosomal protein S6 kinase beta-1 (RPS6KB1 or S6K1) gene in two unrelated Indian families as a potential candidate gene for HCM. The two unrelated HCM families had the same heterozygous missense S6K1 variant (p.G47W). In a replication association study, we identified two S6K1 heterozygotes variants (p.Q49K and p.Y62H) in the UK Biobank cardiomyopathy cohort (n=190) compared with matched controls (n=16 479). These variants are neither detected in region-specific controls nor in the human population genome data. Additionally, we observed an S6K1 variant (p.P445S) in an Arab patient with HCM. Functional consequences were evaluated using representative S6K1 mutated proteins compared with wild type in cellular models. The mutated proteins activated the S6K1 and hyperphosphorylated the rpS6 and ERK1/2 signalling cascades, suggesting a gain-of-function effect.ConclusionsOur study demonstrates for the first time that the variants in the S6K1 gene are associated with HCM, and early detection of the S6K1 variant carriers can help to identify family members at risk and subsequent preventive measures. Further screening in patients with HCM with different ethnic populations will establish the specificity and frequency of S6K1 gene variants.
Khadija Shahab Turabi, Ankita Deshmukh, Sayan Paul, Dayanand Swami, Shafina Siddiqui, Urwashi Kumar, Shreelekha Naikar, Shine Devarajan, Soumya Basu, Manash K. Paul,et al.
Springer Science and Business Media LLC
Sayan Paul, Subburathinam Balakrishnan, Arun Arumugaperumal, Saranya Lathakumari, Sandhya Soman Syamala, Vijithkumar Vijayan, Selvan Christyraj Jackson Durairaj, Vaithilingaraja Arumugaswami, and Sudhakar Sivasubramaniam
Springer Science and Business Media LLC
Among the annelids, earthworms are renowned for their phenomenal ability to regenerate the lost segments. The adult earthworm Eudrilus eugeniae contains 120 segments and the body segments of the earthworm are divided into pre-clitellar, clitellar and post-clitellar segments. The present study denoted that clitellum plays vital role in the successful regeneration of the species. We have performed histological studies to identify among the three skin layers of the earthworm, which cellular layer supports the blastema formation and regeneration of the species. The histological evidences denoted that the proliferation of the longitudinal cell layer at the amputation site is crucial for the successful regeneration of the earthworm and it takes place only in the presence of an intact clitellum. Besides we have performed clitellar transcriptome analysis of the earthworm Eudrilus eugeniae to monitor the key differentially expressed genes and their associated functions and pathways controlling the clitellar tissue changes during both anterior and posterior regeneration of the earthworm. A total of 4707 differentially expressed genes (DEGs) were identified between the control clitellum and clitellum of anterior regenerated earthworms and 4343 DEGs were detected between the control clitellum and clitellum of posterior regenerated earthworms. The functional enrichment analysis confirmed the genes regulating the muscle mass shape and structure were significantly downregulated and the genes associated with response to starvation and anterior-posterior axis specification were significantly upregulated in the clitellar tissue during both anterior and posterior regeneration of the earthworm. The RNA sequencing data of clitellum and the comparative transcriptomic analysis were helpful to understand the complex regeneration process of the earthworm.
Sayan Paul, Sudalai Mani Dinesh Kumar, Sandhya Soman Syamala, Subburathinam Balakrishnan, Vijithkumar Vijayan, Vaithilingaraja Arumugaswami, and Sivasubramaniam Sudhakar
Springer Science and Business Media LLC
BACKGROUND
The arrestin domain containing proteins (ARRDCs) are crucial adaptor proteins assist in signal transduction and regulation of sensory physiology. The molecular localization of the ARRDC gene has been confined mainly to the mammalian system while in invertebrates the expression pattern was not addressed significantly. The present study reports the identification, tissue specific expression and functional characterization of an ARRDC transcript in earthworm, Eudrilus eugeniae.
METHODS AND RESULTS
The coding region of earthworm ARRDC transcript was 1146 bp in length and encoded a protein of 381 amino acid residues. The worm ARRDC protein consists of conserved N-terminal and C-terminal regions and showed significant homology with the ARRDC3 sequence of other species. The tissue specific expression analysis through whole mount in-situ hybridization denoted the expression of ARRDC transcript in the central nervous system of the worm which includes cerebral ganglion and ventral nerve cord. Besides, the expression of ARRDC gene was observed in the epidermal region of earthworm skin. The functional characterization of ARRDC gene was assessed through siRNA silencing and the gene was found to play key role in the light sensing ability and photophobic movement of the worm.
CONCLUSIONS
The neuronal and dermal expression patterns of ARRDC gene and its functional characterization hypothesized the role of the gene in assisting the photosensory cells to regulate the process of photoreception and phototransduction in the worm.
Xinyu Miao, Ramasamy Rajesh Kumar, Qiqi Shen, Zijiang Wang, Qingzi Zhao, Joginder Singh, Sayan Paul, Wei Wang, and Xiaona Shang
Springer Science and Business Media LLC
Avradip Chatterjee, Sayan Paul, Bharti Bisht, Shelley Bhattacharya, Sudhakar Sivasubramaniam, and Manash K. Paul
Elsevier BV
WNT/β-catenin signaling orchestrates various physiological processes, including embryonic development, growth, tissue homeostasis, and regeneration. Abnormal WNT/β-catenin signaling is associated with various cancers and its inhibition has shown effective antitumor responses. In this review, we discuss the pathway, potential targets for the development of WNT/β-catenin inhibitors, available inhibitors, and their specific molecular interactions with the target proteins. We also discuss inhibitors that are in clinical trials and describe potential new avenues for therapeutically targeting the WNT/β-catenin pathway. Furthermore, we introduce emerging strategies, including artificial intelligence (AI)-assisted tools and technology-based actionable approaches, to translate WNT/β-catenin inhibitors to the clinic for cancer therapy.
Mohammad Javad Mehran, Basaralu Yadurappa Sathish Kumar, Nanjundappa Haraprasad, Rambod Barzigar, Bashasab Fakrudin, and Sayan Paul
EManuscript Technologies
Background: The advancement of plant biotechnology improved crop production by revolutionizing plant science. Humans were commonly infected by Helicobacter pylori, and it was closely linked to stomach ulcers and cancer. In addition to traditional vaccines for H. pylori, transgenic plants have also been produced to produce its antigens as well as edible and non-edible parts that can produce an immune response after consumption. The protein present in H. pylori associated with virulence (iceA1) is believed to predispose to stomach cancer. Objectives: The current study was aimed to evaluate the iceA1 gene expression within brinjal plant to produce novel transgenic lines LC420461-B7, -B10, -B15, -B22 and -B27. Materials and Methods: In the present study, amplified iceA1 gene from H. pylori strain 26695 was transformed into callus of brinjal (from leaf explants) through Agrobacterium tumefacians (EHA105). pBI121 vector was used in constructing the plant expression vector, and the transgenics generated were further evaluated by quantitative Real-Time PCR and western blot analysis. Results: Out of the 46 plants obtained five of them were found to be positive for the iceA1 expression. Both real time and western blot confirmed of the presence of expressed gene iceA1 within the plant sample leaves. By studying transgenic brinjal, the study may result in an H. pylori vaccine candidate. As well, the data can be used by researchers to get valid scientific information.
Ranjith Kumavath, Sayan Paul, Honey Pavithran, Manash K. Paul, Preetam Ghosh, Debmalya Barh, and Vasco Azevedo
MDPI AG
Cardiac glycosides are natural sterols and constitute a group of secondary metabolites isolated from plants and animals. These cardiotonic agents are well recognized and accepted in the treatment of various cardiac diseases as they can increase the rate of cardiac contractions by acting on the cellular sodium potassium ATPase pump. However, a growing number of recent efforts were focused on exploring the antitumor and antiviral potential of these compounds. Several reports suggest their antitumor properties and hence, today cardiac glycosides (CG) represent the most diversified naturally derived compounds strongly recommended for the treatment of various cancers. Mutated or dysregulated transcription factors have also gained prominence as potential therapeutic targets that can be selectively targeted. Thus, we have explored the recent advances in CGs mediated cancer scope and have considered various signaling pathways, molecular aberration, transcription factors (TFs), and oncogenic genes to highlight potential therapeutic targets in cancer management.
Sayan Paul, Subburathinam Balakrishnan, Arun Arumugaperumal, Saranya Lathakumari, Sandhya Soman Syamala, Vaithilingaraja Arumugaswami, and Sudhakar Sivasubramaniam
Springer Science and Business Media LLC
The oligochaete earthworm, Eudrilus eugeniae is capable of regenerating both anterior and posterior segments. The present study focuses on the transcriptome analysis of earthworm E. eugeniae to identify and functionally annotate the key genes supporting the anterior blastema formation and regulating the anterior regeneration of the worm. The Illumina sequencing generated a total of 91,593,182 raw reads which were assembled into 105,193 contigs using CLC genomics workbench. In total, 40,946 contigs were annotated against the NCBI nr and SwissProt database and among them, 15,702 contigs were assigned to 14,575 GO terms. Besides a total of 9389 contigs were mapped to 416 KEGG biological pathways. The RNA-Seq comparison study identified 10,868 differentially expressed genes (DEGs) and of them, 3986 genes were significantly upregulated in the anterior regenerated blastema tissue samples of the worm. The GO enrichment analysis showed angiogenesis and unfolded protein binding as the top enriched functions and the pathway enrichment analysis denoted TCA cycle as the most significantly enriched pathway associated with the upregulated gene dataset of the worm. The identified DEGs and their function and pathway information can be effectively utilized further to interpret the key cellular, genetic and molecular events associated with the regeneration of the worm.
Sathyalakshmi Alaguponniah, Deepa Velayudhan Krishna, Sayan Paul, Johnson Retnaraj Samuel Selvan Christyraj, Krishnan Nallaperumal, and Sudhakar Sivasubramaniam
Elsevier BV
Telomeres, the nucleoprotein structures, located at the end of the chromosomes are correlated with cancer and aging. The accelerated telomere attrition can accelerate human aging and leads to the progression of several cancers. Our work describes the finding of two novel telomeric repeats "CACAGA" and "TCTCTGCGCCTGCGCCGGCGCGGCGCGCC" and demonstrates their distribution in human chromosomes compare to the reported telomeric repeat TTAGGG. Simultaneously, the distance between the adjacent telomeric repeats (loop) was determined and the presence of shorter loops in the telomeric regions might address the correlation between the telomere attrition and senescence condition in human.
Gustavo Garcia, Sayan Paul, Sara Beshara, V. Krishnan Ramanujan, Arunachalam Ramaiah, Karin Nielsen-Saines, Melody M.H. Li, Samuel W. French, Kouki Morizono, Ashok Kumar,et al.
Elsevier BV
Zika virus (ZIKV) is a reemerging human pathogen that causes congenital abnormalities including microcephaly and eye disease. The cellular/molecular basis of ZIKV and host interactions inducing ocular and neuronal pathogenesis are unclear. Here we noted that the Hippo/ Salvador-Warts-Hippo (SWH) signaling pathway, which controls organ size through progenitor cell proliferation and differentiation, is dysregulated following ZIKV infection. In human fetal retinal pigment epithelial (RPE) cells, there is an early induction of transcriptional co-activator, YAP, which is later degraded with a corresponding activation of the TBK1-IRF3 Type I interferon pathway. YAP/TAZ silencing results in reduced ZIKV replication, indicating a direct role of Hippo pathway in regulating ZIKV infection. Using an in vivo Ifnar1-/- knockout mouse model, ZIKV infection was found to reduce YAP/TAZ protein levels while increasing pYAP Ser127 in the retina and brain. Hippo pathway is activated in major cellular components of the blood-brain barrier (BBB), including endothelial cells and astrocytes. In addition, our result suggests AMPK signaling pathway's role in regulating YAP/TAZ in ZIKV-infected cells. Our data demonstrates that ZIKV infection might initiate a crosstalk among AMPK-Hippo-TBK1 pathways, which could regulate antiviral and energy stress responses during oculo-neuronal inflammation.
Arun Arumugaperumal, Sayan Paul, Saranya Lathakumari, Ravindran Balasubramani, and Sudhakar Sivasubramaniam
Springer Science and Business Media LLC
Abstract Purpose Verminephrobacter is a genus of symbiotic bacteria that live in the nephridia of earthworms. The bacteria are recruited during the embryonic stage of the worm and transferred from generation to generation in the same manner. The worm provides shelter and food for the bacteria. The bacteria deliver micronutrients to the worm. The present study reports the genome sequence assembly and annotation of a new strain of Verminephrobacter called Verminephrobacter eiseniae msu. Methods We separated the sequences of a new Verminephrobacter strain from the whole genome of Eisenia fetida using the sequence of V. eiseniae EF01-2, and the bacterial genome was assembled using the CLC Workbench. The de novo-assembled genome was annotated and analyzed for the protein domains, functions, and metabolic pathways. Besides, the multigenome comparison was performed to interpret the phylogenomic relationship of the strain with other proteobacteria. Result The FastqSifter sifted a total of 593,130 Verminephrobacter genomic reads. The de novo assembly of the reads generated 1832 contigs with a total genome size of 4.4 Mb. The Average Nucleotide Identity denoted the bacterium belongs to the species V. eiseniae, and the 16S rRNA analysis confirmed it as a new strain of V. eiseniae. The AUGUSTUS genome annotation predicted a total of 3809 protein-coding genes; of them, 3805 genes were identified from the homology search. Conclusion The bioinformatics analysis confirmed the bacterium is an isolate of V. eiseniae, and it was named Verminephrobacter eiseniae msu. The whole genome of the bacteria can be utilized as a useful resource to explore the area of symbiosis further.
Sayan Paul, Lars-Henrik Heckmann, Jesper G. Sørensen, Martin Holmstrup, Arun Arumugaperumal, and Sudhakar Sivasubramaniam
Elsevier BV
Abstract The lumbricid earthworm Dendrobaena octaedra , widely distributed in the northern hemisphere, is a freeze tolerant worm species known for its ability to acclimate to the extreme cold condition. However, at the genome and transcriptome level, the species has not been explored to a great extent. The present study focuses on transcriptome analysis of Dendrobaena octaedra to identify and functionally annotate the potential transcripts and biological pathways associated with the freeze tolerance of the species. The Roche 454 pyrosequencing generated 181,856 reads for warm acclimated worms and 190,209 reads for cold acclimated worms which were de novo assembled to 6336 isotigs using the Newbler 2.3 assembler. In total, 2665 isotigs were annotated against the NCBI nr database and of them, 1753 isotigs were assigned to 9546 GO terms. The conserved domain analysis using InterProScan annotated 6309 isotigs into 1307 domains with EF-hand domain as the most highly represented domain. Further, the COG annotation classified 1426 isotigs into 25 functional categories and 895 isotigs were mapped to 90 KEGG pathways. Among them, 22 pathways were functionally enriched in the cold acclimated worms. The RNA seq analysis showed 96 differentially expressed genes of which 50 genes were upregulated in the cold acclimated worms. In addition, we identified 72 molecular chaperones which may have effect in regulating the cold tolerance of the species. The complete transcriptome resource of Dendrobaena octaedra can be effectively utilized further to interpret the key genetic, molecular and physiological mechanisms regulating the freeze tolerance and cold acclimation process of the species.
Lelin Chinnadurai, Thirumalaikumar Eswaramoorthy, Abinaya Paramachandran, Sayan Paul, Rashmi Rathy, Arun Arumugaperumal, Sudhakar Sivasubramaniam, and Citarasu Thavasimuthu
American Society for Microbiology
The Escherichia coli phage CMSTMSU was isolated from shrimp farm effluent water in Ramanathapuram, India. The phage exhibited lytic activity against both E. coli and the fish pathogen Pseudomonas aeruginosa .
Sayan Paul, Arun Arumugaperumal, Rashmi Rathy, Vasanthakumar Ponesakki, Palavesam Arunachalam, and Sudhakar Sivasubramaniam
Elsevier BV
The present article reports the complete draft genome annotation of earthworm Eisenia fetida, obtained from the manuscript entitled “Timing and Scope of Genomic Expansion within Annelida: Evidence from Homeoboxes in the Genome of the Earthworm E. fetida” (Zwarycz et al., 2015) and provides the data on the repetitive elements, protein coding genes and noncoding RNAs present in the genome dataset of the species. The E. fetida protein coding genes were predicted from AUGUSTUS gene prediction and subsequently annotated based on their sequence similarity, Gene Ontology (GO) functional terms, InterPro domains, Clusters of Orthologous Groups (COGs) and KEGG (Kyoto Encyclopedia of Genes and Genomes) pathways information. The genome wide comparison of orthologous clusters and phylogenomic analysis of the core genes were performed to understand the events of genome evolution and genomic diversity between E. fetida and its related metazoans. In addition, the genome dataset was screened to identify the crucial stem cell markers, regeneration specific genes and immune-related genes and their functionally enriched GO terms were predicted from Fisher׳s enrichment analysis. The E. fetida genome annotation data containing the GFF (general feature format) annotation file, predicted coding gene sequences and translated protein sequences were deposited to the figshare repository under the DOI: https://doi.org/10.6084/m9.figshare.6142322.v1.
Rashmi Rathy, Sayan Paul, Vasanthakumar Ponesakki, Paulkumar Kanniah, Suriya Prabha Muthu, Arun Arumugaperumal, Emmanuel Joshua Jebasingh Sathiya Balasingh Thangapandi, Subburathinam Balakrishnan, Rajendhran Jeyaprakash, and Sudhakar Sivasubramaniam
Elsevier BV
Bacillus species 062011 msu is a harmful pathogenic strain responsible for causing abscessation in sheep and goat population studied by Mariappan et al. (2012) [1]. The organism specifically targets the female sheep and goat population and results in the reduction of milk and meat production. In the present study, we have performed the whole genome sequencing of the pathogenic isolate using the Ion Torrent sequencing platform and generated 458,944 raw reads with an average length of 198.2 bp. The genome sequence was assembled, annotated and analysed for the genetic islands, metabolic pathways, orthologous groups, virulence factors and antibiotic resistance genes associated with the pathogen. Simultaneously the 16S rRNA sequencing study and genome sequence comparison data confirmed that the strain belongs to the species Bacillus cereus and exhibits 99% sequence homo;logy with the genomes of B. cereus ATCC 10987 and B. cereus FRI-35. Hence, we have renamed the organism as Bacillus cereus 062011msu. The Whole Genome Shotgun (WGS) project has been deposited at DDBJ/ENA/GenBank under the accession NTMF00000000 (https://www.ncbi.nlm.nih.gov/bioproject/PRJNA404036(SAMN07629099)).
Vasanthakumar Ponesakki, Sayan Paul, Dinesh Kumar Sudalai Mani, Veeraragavan Rajendiran, Paulkumar Kanniah, and Sudhakar Sivasubramaniam
Elsevier BV
In annelid worms, the nerve cord serves as a crucial organ to control the sensory and behavioral physiology. The inadequate genome resource of earthworms has prioritized the comprehensive analysis of their transcriptome dataset to monitor the genes express in the nerve cord and predict their role in the neurotransmission and sensory perception of the species. The present study focuses on identifying the potential transcripts and predicting their functional features by annotating the transcriptome dataset of nerve cord tissues prepared by Gong et al., 2010 from the earthworm Eisenia fetida. Totally 9762 transcripts were successfully annotated against the NCBI nr database using the BLASTX algorithm and among them 7680 transcripts were assigned to a total of 44,354 GO terms. The conserve domain analysis indicated the over representation of P-loop NTPase domain and calcium binding EF-hand domain. The COG functional annotation classified 5860 transcript sequences into 25 functional categories. Further, 4502 contig sequences were found to map with 124 KEGG pathways. The annotated contig dataset exhibited 22 crucial neuropeptides having considerable matches to the marine annelid Platynereis dumerilii, suggesting their possible role in neurotransmission and neuromodulation. In addition, 108 human stem cell marker homologs were identified including the crucial epigenetic regulators, transcriptional repressors and cell cycle regulators, which may contribute to the neuronal and segmental regeneration. The complete functional annotation of this nerve cord transcriptome can be further utilized to interpret genetic and molecular mechanisms associated with neuronal development, nervous system regeneration and nerve cord function.